> For the complete documentation index, see [llms.txt](https://code-snippets.hbamithkumara.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://code-snippets.hbamithkumara.com/leetcode/problems/101-200/repeated-dna-sequences.md).

# 187. Repeated DNA Sequences

### Description

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

### Constraints

### Approach

### Links

* GeeksforGeeks
* [Leetcode](https://leetcode.com/problems/repeated-dna-sequences/)
* [ProgramCreek](https://www.programcreek.com/2014/03/leetcode-repeated-dna-sequences-java/)
* YouTube

### **Examples**

{% tabs %}
{% tab title="Example 1" %}
**Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

**Output:** \["AAAAACCCCC", "CCCCCAAAAA"]
{% endtab %}
{% endtabs %}

### **Solutions**

{% tabs %}
{% tab title="Solution 1" %}

```java
/**
 * Time complexity : O((N−L)L), that is O(N) for the constant L=10. In the 
 *    loop executed N−L+1 one builds a substring of length L. Overall that 
 *    results in O((N−L)L) time complexity.
 * Space complexity : O((N−L)L) to keep the hashset, that results in O(N) 
 *		for the constant L=10.
 */

class Solution {
	public List<String> findRepeatedDnaSequences(String s) {
		int L = 10, n = s.length();
		HashSet<String> seen = new HashSet(), output = new HashSet();

		// iterate over all sequences of length L
		for (int start = 0; start < n - L + 1; ++start) {
			String tmp = s.substring(start, start + L);
			if(seen.contains(tmp)) output.add(tmp);
			seen.add(tmp);
		}

		return new ArrayList<String>(output);
	}
}
```

{% endtab %}
{% endtabs %}

### **Follow up**

*