# 187. Repeated DNA Sequences

### Description

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

### Constraints

### Approach

### Links

* GeeksforGeeks
* [Leetcode](https://leetcode.com/problems/repeated-dna-sequences/)
* [ProgramCreek](https://www.programcreek.com/2014/03/leetcode-repeated-dna-sequences-java/)
* YouTube

### **Examples**

{% tabs %}
{% tab title="Example 1" %}
**Input:** s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

**Output:** \["AAAAACCCCC", "CCCCCAAAAA"]
{% endtab %}
{% endtabs %}

### **Solutions**

{% tabs %}
{% tab title="Solution 1" %}

```java
/**
 * Time complexity : O((N−L)L), that is O(N) for the constant L=10. In the 
 *    loop executed N−L+1 one builds a substring of length L. Overall that 
 *    results in O((N−L)L) time complexity.
 * Space complexity : O((N−L)L) to keep the hashset, that results in O(N) 
 *		for the constant L=10.
 */

class Solution {
	public List<String> findRepeatedDnaSequences(String s) {
		int L = 10, n = s.length();
		HashSet<String> seen = new HashSet(), output = new HashSet();

		// iterate over all sequences of length L
		for (int start = 0; start < n - L + 1; ++start) {
			String tmp = s.substring(start, start + L);
			if(seen.contains(tmp)) output.add(tmp);
			seen.add(tmp);
		}

		return new ArrayList<String>(output);
	}
}
```

{% endtab %}
{% endtabs %}

### **Follow up**

*


---

# Agent Instructions: Querying This Documentation

If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter:

```
GET https://code-snippets.hbamithkumara.com/leetcode/problems/101-200/repeated-dna-sequences.md?ask=<question>
```

The question should be specific, self-contained, and written in natural language.
The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.